Skip to main content

Advertisement

Table 1 Primer pairs for qPCR analysis. This table only shows the highest efficiency primer pairs, as well as the primers used to produce the purified PCR products for the standard curves

From: Molecular analysis of the Sydney rock oyster (Saccostrea glomerata) CO2 stress response

Transcript Primer ID Sequence (5′ to 3′) Length (bp)
tektin-2 T2F_1 CCACACCCTTCAGCAGTGT 19
T2R_1 GCGATCTTTGCGCGGATTT 19
T2F_2 AGTTCGCCAGGAGAGTCGA 19
T2R_4 CTCCTCTAGAGCCCTCTTCGT 21
tektin-4-like T4F_1 ACAATGGGGTTCAGGGCTG 19
T4R_2 CGGACGCTGACACACTTGT 19
T4F_3 TGAGAGAATTCGCCACGAG 19
T4R_3 TGTTGCACGGAGTCCATTT 19